Review



snapf sequence  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc snapf sequence
    Snapf Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snapf sequence/product/Addgene inc
    Average 93 stars, based on 15 article reviews
    snapf sequence - by Bioz Stars, 2026-05
    93/100 stars

    Images



    Similar Products

    snapf coding sequence  (New England Biolabs)
    94
    New England Biolabs snapf coding sequence
    Snapf Coding Sequence, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snapf coding sequence/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    snapf coding sequence - by Bioz Stars, 2026-05
    94/100 stars
    		  Buy from Supplier
    snapf sequence  (Addgene inc)
    93
    Addgene inc snapf sequence
    Snapf Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snapf sequence/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    snapf sequence - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    snapf-tag dna sequence  (GenScript corporation)
    90
    GenScript corporation snapf-tag dna sequence
    Snapf Tag Dna Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snapf-tag dna sequence/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    snapf-tag dna sequence - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    interest sequence source notes pkg1117 ppv0 pship backbone addgene  (Addgene inc)
    92
    Addgene inc interest sequence source notes pkg1117 ppv0 pship backbone addgene
    Interest Sequence Source Notes Pkg1117 Ppv0 Pship Backbone Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/interest sequence source notes pkg1117 ppv0 pship backbone addgene/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    interest sequence source notes pkg1117 ppv0 pship backbone addgene - by Bioz Stars, 2026-05
    92/100 stars
    		  Buy from Supplier
    snaptag pentr4 snapf w878 1 sequences  (Addgene inc)
    93
    Addgene inc snaptag pentr4 snapf w878 1 sequences
    Snaptag Pentr4 Snapf W878 1 Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snaptag pentr4 snapf w878 1 sequences/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    snaptag pentr4 snapf w878 1 sequences - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier
    catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat sequence right  (Addgene inc)
    93
    Addgene inc catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat sequence right
    Catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat Sequence Right, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat sequence right/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    catcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat sequence right - by Bioz Stars, 2026-05
    93/100 stars
    		  Buy from Supplier

    Image Search Results